Problems visualizing larger RNA molecules with FornaContainer

Dash Python
1

Hello Dash community!

I am currently building a lightweight dash app for my Biology collegues to map Protein-RNA interactions onto RNA 2D structures.

My problem is that the layout of the FORNA container works fine with small molecules but is very messy with larger ones:

FornaContainer
FornaContainer1789×957 155 KB

Would it be possible to extend the input parameters with precomputed X and Y coordinates?

sequences = {
    'PDB_01019': {
        'sequence': 'AUGGGCCCGGGCCCAAUGGGCCCGGGCCCA',
        'structure': '.((((((())))))).((((((()))))))',
        'x_position':[some precomputed list]
        'y_position':[some precomputed list]
    }

Thanks in advance!

Martin